|  Help  |  About  |  Contact Us

Allele : Zfhx4<em1(IMPC)J> zinc finger homeodomain 4; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6400544 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Zfhx4
Inheritance Mode  Not Specified Strain of Origin  Not Specified
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGGAGAGTCACAGGTTTCCA and ACAGCAGCGGCTCTGGCACC, which resulted in a 2576 bp deletion beginning at Chromosome 3 position 5,241,715 bp and ending after 5,244,290 bp (GRCm38/mm10). This mutation deletes 2576 bp of ENSMUSE00000386485 (exon 2) including the start site and is predicted to generate a null allele.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories