| Primary Identifier | MGI:6400544 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zfhx4 |
| Inheritance Mode | Not Specified | Strain of Origin | Not Specified |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGGAGAGTCACAGGTTTCCA and ACAGCAGCGGCTCTGGCACC, which resulted in a 2576 bp deletion beginning at Chromosome 3 position 5,241,715 bp and ending after 5,244,290 bp (GRCm38/mm10). This mutation deletes 2576 bp of ENSMUSE00000386485 (exon 2) including the start site and is predicted to generate a null allele. |