| Primary Identifier | MGI:6403852 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Brcc3dc |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGAAGACAGCTCTTCCATA and GATGGCGGTGCGGATGATGC, which resulted in a 846 bp deletion beginning at Chromosome 10 position 108,699,232 bp and ending after 108,700,077 bp (GRCm38/mm10). This mutation deletes 846 bp from ENSMUSE00001410224 (exon 1) and is predicted to cause a change of amino acid sequence after residue 5 remove 282 amino acids, return to frame for the last 4 amino acids before the stop. |
