|  Help  |  About  |  Contact Us

Allele : Pop5<em1(IMPC)J> processing of precursor 5, ribonuclease P/MRP family (S. cerevisiae); endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6403854 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Pop5
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGATTTCGACAGTTTTGTGG and GCGTTTTGTACGATAGTGGA, which resulted in a 611 bp deletion beginning at Chromosome 5 position 115,237,751 bp and ending after 115,238,361 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000519136, ENSMUSE00000465080 (exons 2 and 3) and 222 bp of flanking intronic sequence including the splice acceptor, donor and start site and is predicted to generate a null allele.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Pop5<->,
  • Pop5<->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

5 Publication categories