| Primary Identifier | MGI:6403860 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | H2az1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCCAATGGGAGAACGCACAG and GTACTTTCGTTGTACCCTGA, which resulted in a 2664 bp deletion beginning at Chromosome 3 position 137,864,450 bp and ending after 137,867,113 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000669244, ENSMUSE00001255094, ENSMUSE00001280001, ENSMUSE00001260075, ENSMUSE00000635681 (exons 1-5) and 1575 bp of flanking intronic sequence including the splice acceptor, donor and start site. This deletion is predicted to generate a null allele. |
