| Primary Identifier | MGI:6403863 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ociad1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TATGGTCATCAGCCCCCGAG and GTCTACTCATGACTCTAGAT, which resulted in a 4204 bp deletion beginning at Chromosome 5 position 73,306,259 bp and ending after 73,310,462 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000228593, ENSMUSE00000228583 (exons 7 and 8) and 3873 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 126 and early truncation 10 amino acids later. |