| Primary Identifier | MGI:6403878 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cdkn2aip |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTTGAGGATGTTTCAGTGC and TCTACGGCTCGTTTTTTGGA, which resulted in a 1262 bp deletion beginning at Chromosome 8 position 47,711,014 bp and ending after 47,712,275 bp (GRCm38/mm10). This mutation deletes 1262 bp from ENSMUSE00001390013 (exon 3) and is predicted to cause a change of amino acid sequence after residue 134 and early truncation 15 amino acids later. |
