|  Help  |  About  |  Contact Us

Allele : Tifab<em1(IMPC)J> TRAF-interacting protein with forkhead-associated domain, family member B; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6404191 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tifab
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAGCCTTGGGTCTGTAAATC and GAGCCTGTACCACCCTACAC, which resulted in a 368 bp deletion beginning at Chromosome 13 position 56,176,215 bp and ending after 56,176,582 bp (GRCm38/mm10). This mutation deletes 368 bp from ENSMUSE00001037023 (exon 3) and is predicted to cause a change of amino acid sequence after residue 15 and early truncation 17 amino acids later. There is a 4 bp insertion (GGCT) at the deletion site.
  • mutations:
  • Intragenic deletion,
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele