|  Help  |  About  |  Contact Us

Allele : Cd4<em3(IMPC)H> CD4 antigen; endonuclease-mediated mutation 3, Harwell

Primary Identifier  MGI:6404494 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cd4
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NTac
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 Protein and 2 guide sequences CCTTTTTTGGAATCAAAACGATC, CAGGCTGGTACCCGGACTGAAGG, which resulted in a Indel.
  • mutations:
  • Intragenic deletion,
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories