| Primary Identifier | MGI:6432397 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ms4a4d |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AATGCTACATTCCCATTTAA and ATGGCGGGATGCCATGGAGG, which resulted in a 6557 bp deletion beginning at Chromosome 19 position 11,548,405 bp and ending after 11,554,961 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000991798, ENSMUSE00000985830, ENSMUSE00001086305, ENSMUSE00000144349 (exons 2,3,4,5) and 6097 bp of flanking intronic sequence including the splice acceptor, donor and start site and is predicted to generate a null allele. There is a 3 bp deletion (ATT) 24 bp before the larger deletion. |
