| Primary Identifier | MGI:6437877 | Allele Type | Endonuclease-mediated |
| Attribute String | Reporter | Gene | Mecp2 |
| Transmission | Germline | Strain of Origin | 129P2/OlaHsd |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | CRIPSPR-targeting replaced the sequence encoding the methyl-CpG binding domain (MBD) of Mecp2 (NCBI NM_010788 c. 280-492 and intron 3; p. 94-164) with the homologous sequence from MBD2 (NCBI NM_010773 c. 457-651, excluding the intron; p. 153-217). The gene was tagged at the C-terminus by EGFP connected with a short linker (TGTAAGGATCCACCGGTCGCCACC). Cre-mediated recombination removed the selection cassette in intron 2. |
