|  Help  |  About  |  Contact Us

Allele : Exoc3l<em1(IMPC)J> exocyst complex component 3-like; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6406426 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Exoc3l
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AATTGCACTGTTGCTTTCAC and GCTGTACCCATAGCCCAGAT, which resulted in a 4024 bp deletion beginning at Chromosome 8 position 105,289,880 bp and ending after 105,293,903 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000411822, ENSMUSE00000371260, ENSMUSE00000382733, ENSMUSE00000363245, ENSMUSE00000333253, ENSMUSE00000333141, ENSMUSE00000344357, ENSMUSE00000389567, ENSMUSE00000365886, and ENSMUSE00000354408 (exons 5-14) and 2197 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 143 and early truncation 42 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories