| Primary Identifier | MGI:6415700 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Gm7694 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTACAACTGGGATAATGGG and GCAATATACCCCAAACCTTC, which resulted in a 516 bp deletion beginning at Chromosome 1 position 170,302,481 bp and ending after 170,302,996 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000687523 (exon 2) and 188 bp of flanking intronic sequence including the splice acceptor, donor and start site and is predicted to generate a null allele. |
