|  Help  |  About  |  Contact Us

Allele : Tyr<em19Ove> tyrosinase; endonuclease-mediated mutation 19, Paul Overbeek

Primary Identifier  MGI:6416505 Allele Type  Endonuclease-mediated
Attribute String  Not Specified Gene  Tyr
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/Cas9 for targeted gene repair with one sgRNA and overlapping oligonucleotide donors to repair the C57 albino mutation. More specifically, embryo injections were done using two guide RNAs, termedPAM1 and PAM2. These guides target sites in the mouse genome located on eitherside of the C57albino mutation at amino acid 77 of the tyrosinase gene. The target sequence for the PAM1 guide RNA was tcagttccccttcaaagggg (tgg). Thetarget sequence for the PAM2 guide RNA was acacagagggccaggactca (ngg). Thedonor DNA was a mixture of two 81 base, 3- dideoxy-capped, oligonucleotidestermed 174 (5- gca cca tct gga cct cag ttc ccc ttc aaa gga gtt gat gataga gag tcc tgg ccc tct gtg ttt tat aat agg acc tgc) and 175 (5- ggt cct attata aaa cac aga ggg cca gga ctc tct atc atc aac tcc ttt gaa ggg gaa ctg agg tccaga tgg tgc ac). These oligos encode thewild-type tyrosinase amino acid sequence (codon 77 underlined) and also alterthe guide RNA target sites to prevent re-cleavage after gene repair. The sequencing revealed thattandem copies of the 81-nucleotide donor sequence had integrated into thegenome.
  • mutations:
  • Insertion,
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories