| Primary Identifier | MGI:6442544 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ccdc198 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from IMPC was generated at Czech centre for Phenogenomics by injecting CAS9 Protein and 2 guide sequences CCGACTAGTCTGTACTGGAAATG, CCAAGTGCTAGATTCAGGTCCTT, which resulted in an Exon Deletion. A founder harboring a 661 bp deletion overlapping the entire exon 3 of the gene was used for subsequent breeding. |
