|  Help  |  About  |  Contact Us

Allele : Ripk1<em2Hbz> receptor (TNFRSF)-interacting serine-threonine kinase 1; endonuclease-mediated mutation 2, Haibing Zhang

Primary Identifier  MGI:6449646 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ripk1
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/Cas9 genome editing technology was used with an sgRNA targeting GACCTAGACAGCGGAGGCTT and an ssODN template to delete a 6 bp sequence, resulting in the deletion of two highly conserved amino acids, F28 and G29, from the P-loop of the N-terminal kinase domain of the encoded protein.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Rip1<delta>,
  • Rip1<delta>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

4 Publication categories

Trail: Allele