| Primary Identifier | MGI:6449646 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ripk1 |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/Cas9 genome editing technology was used with an sgRNA targeting GACCTAGACAGCGGAGGCTT and an ssODN template to delete a 6 bp sequence, resulting in the deletion of two highly conserved amino acids, F28 and G29, from the P-loop of the N-terminal kinase domain of the encoded protein. |
