|  Help  |  About  |  Contact Us

Allele : Setbp1<em2Lutzy> SET binding protein 1; endonuclease-mediated mutation 2, Cathy Lutz

Primary Identifier  MGI:6452200 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Setbp1
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/Cas9 genome editing is used to insert a S858R point mutation (AGC to AGG on the sense strand) using guide RNA [sense strand; GAGACTATCCCGAGCGACAG] in combination with stranded oligonucleotide donor DNAs [antisense strand; GGAACAGAAGTCGAAAGAGTACCTCCGCCGGGATTCTGAACTCTTCTCTGCTTGGTCGGAGGTGCTGTTGTTGTCTGTCCCGATGCCACTGTCCCTCGGGATAGTCTCCTCGCTGTGGGACTCACTC]. The S858R point mutation associated with Schinzel-Giedion midface retraction syndrome, and Mental retardation, autosomal dominant 29.
  • mutations:
  • Insertion,
  • Nucleotide substitutions
  • synonyms:
  • Setbp1<S858R>,
  • Setbp1<S858R>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories