| Primary Identifier | MGI:6452851 | Allele Type | Endonuclease-mediated |
| Attribute String | Epitope tag | Gene | Tmie |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Using CRISPR/Cas9 technology, sequence 5'-GGCGGCAGCGGCGAGCAGAAACTCATCTCTGAAGAAGATCTGGAACAAAAGTTGATTTCAGAAGAAGATC TGGAACAGAAGCTCATCTCTGAGGAAGATCTG-3', encoding GGSGEQKLISEEDLEQKLISEEDLEQKLISEEDL, was inserted immediately before the endogenous stop codon, providing the encoded peptide with three copies of a MYC tag linked via a 4 amino-acid linker to the C-terminus. |