|  Help  |  About  |  Contact Us

Allele : Rora<em1Litt> RAR-related orphan receptor alpha; endonuclease-mediated mutation 1, Dan R LIttman

Primary Identifier  MGI:6467242 Allele Type  Endonuclease-mediated
Gene  Rora Strain of Origin  C57BL/6J
Is Recombinase  false Is Wild Type  false
molecularNote  CRISPR/cas9 genome editing is used to introduce twin-strep (TS) tag sequence into the last exon immediately before the stop codon. TS tag encodes two tandem streptavidin-binding peptides (upper case) that are preceded and separated by linker (lower case) sequences: [Last Rora exon: CGGAAAAGCTAATGGCATTTAAAGCAATATACCCAGACATTGTGCGACTCCATTTTCCTCCATTATACAAGGAATTGTTCACTTCAGAATTTGAGCCAGCTATGCAGATTGACGGA] gcaagcggatcggcttcaggatcggcctct TGGTCTCACCCACAGTTCGAGAAG ggaggcggatccggaggtgggtctggcggatccgct TGGTCCCATCCTCAGTTTGAAAAG [TAA stop].
  • mutations:
  • Insertion
  • synonyms:
  • Rora-TS,
  • Rora-TS
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories