| Primary Identifier | MGI:6466696 | Allele Type | Endonuclease-mediated |
| Gene | Unc93b1 | Strain of Origin | C57BL/6J |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | CRISPR/Cas9 genome editing is used to create a guide RNA (TGCTGCGCGGCAGCGTCCGAAGG) designed to change AGC to GCC, resulting in a serine to alanine change at mouse amino acid 303, analogous to amino acid 282 in humans. Since this gene has two start sites, this amino acid would be S303A when cloned from the first alternative start site (MKEVPT). It is unknown if there are any off-target sites present. The mutation was confirmed by sequencing. |
