|  Help  |  About  |  Contact Us

Allele : Unc93b1<em1Gbrt> unc-93 homolog B1, TLR signaling regulator; endonuclease-mediated mutation 1, Greg Barton

Primary Identifier  MGI:6466696 Allele Type  Endonuclease-mediated
Gene  Unc93b1 Strain of Origin  C57BL/6J
Is Recombinase  false Is Wild Type  false
molecularNote  CRISPR/Cas9 genome editing is used to create a guide RNA (TGCTGCGCGGCAGCGTCCGAAGG) designed to change AGC to GCC, resulting in a serine to alanine change at mouse amino acid 303, analogous to amino acid 282 in humans. Since this gene has two start sites, this amino acid would be S303A when cloned from the first alternative start site (MKEVPT). It is unknown if there are any off-target sites present. The mutation was confirmed by sequencing.
  • mutations:
  • Nucleotide substitutions,
  • Insertion
  • synonyms:
  • Unc93b1<S282A>,
  • Unc93b1<S282A>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele