|  Help  |  About  |  Contact Us

Allele : Rr272<em1Mad> regulatory region 272; endonuclease-mediated mutation 1, Michael A Dyer

Primary Identifier  MGI:6469562 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr272
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  This Vsx2 bipolar neuron-specific core regulatory circuit super enhancer (CRC-SE) was targeted with sgRNAs (targeting GCAGGCCATGTGCTCGTCGA and CAGGGTGCAGGCTGACAACG) using CRISPR/Cas9 technology, resulting in slightly different deletions in three independent lines: chr12:84579812-84611543 (Vsx2-3-3), 84579815-84611547 (Vsx2-59-12) and 84579815-84611546 (Vsx2-23-3); all coordinates from build GRCm39. The deletions involve super-enhancer component enhancers Rr274, Rr275 and Rr276 (which contains Rr261800 and Rr268660), but not Rr273, and an alternative exon 1 of Lin52.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • Vsx2<em1Mad>,
  • Vsx2 CRC-SE<delta>,
  • Vsx2-SE<delta>,
  • Vsx2 CRC-SE<delta>,
  • Vsx2<em1Mad>,
  • Vsx2-SE<delta>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

6 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

6 Publication categories