| Primary Identifier | MGI:6469562 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr272 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | This Vsx2 bipolar neuron-specific core regulatory circuit super enhancer (CRC-SE) was targeted with sgRNAs (targeting GCAGGCCATGTGCTCGTCGA and CAGGGTGCAGGCTGACAACG) using CRISPR/Cas9 technology, resulting in slightly different deletions in three independent lines: chr12:84579812-84611543 (Vsx2-3-3), 84579815-84611547 (Vsx2-59-12) and 84579815-84611546 (Vsx2-23-3); all coordinates from build GRCm39. The deletions involve super-enhancer component enhancers Rr274, Rr275 and Rr276 (which contains Rr261800 and Rr268660), but not Rr273, and an alternative exon 1 of Lin52. |
