|  Help  |  About  |  Contact Us

Allele : Tns2<em2Nsas> tensin 2; endonuclease-mediated mutation 2, Nobuya Sasaki

Primary Identifier  MGI:6471943 Allele Type  Endonuclease-mediated
Attribute String  Not Specified Gene  Tns2
Strain of Origin  FVB Is Recombinase  false
Is Wild Type  false
molecularNote  Cysteine codon 231 (TGC) in exon 9 was changed to serine (AGC) (p.C231S) using an sgRNA (targeting CGTGGTTGTGTTGTACTGCA ) and an ssODN template with CRISPR/Cas9 technology.
  • mutations:
  • Single point mutation
  • synonyms:
  • Tns2<C231S>,
  • Tns2<CS>,
  • Tns2<CS>,
  • Tns2<C231S>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories