|  Help  |  About  |  Contact Us

Allele : Gcn1<em1(IMPC)J> GCN1 activator of EIF2AK4; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6477990 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Gcn1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTACAGAGCAGGGCTCAGCA and GCTGGTGTAGAGCCACTGGT, which resulted in a 1611 bp deletion beginning at Chromosome 5 position 115,574,333 bp and ending after 115,575,943 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001249622, ENSMUSE00001219534(exons 3 and 4) and 1415 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 40 and early truncation 11 amino acids later.
  • mutations:
  • Deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories