|  Help  |  About  |  Contact Us

Allele : Brme1<em1Keish> break repair meiotic recombinase recruitment factor 1; endonuclease-mediated mutation 1, Kei-ichiro Ishiguro

Primary Identifier  MGI:6478915 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Brme1
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false
molecularNote  Exons 3-9 were targeted for deletion with two synthetic crRNAs (targeting GCAGGAAGTTCATAGCCACA(ggg) and TGGGTAACAGATCTACACAC(agg)) and an ssODN (GGCTACAACTACAGGGAGGTTTTGTGCTCTCTAACCTGTGaattcGGCTATGAACTTCCTGCCGC CATCAGCTTCCAAAATACAG) using CRISPR/Cas9 technology.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • 4930432K21Rik Ex3-9delta,
  • 4930432K21Rik Ex3-9delta,
  • Brme1 KO,
  • Brme1 KO
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories