| Primary Identifier | MGI:6511794 | Allele Type | Endonuclease-mediated |
| Attribute String | Hypomorph | Gene | Silc1 |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/cas9 mediated recombination created a deletion in exon 1. Using the forward primer TGAAGCATCCCAAGAAATCC and the reverse primer CACAGTCCTGTCCTGGTGTG the sequence remaining in the targeted region is GCACACTGCCTCTGAGATGA. Expression is reduced by more than 90% in cultured adult dorsal root ganglion cells from homozygous mice. |
