|  Help  |  About  |  Contact Us

Allele : Ttn<em1Kage> titin; endonuclease-mediated mutation 1, Katja Gehmlich

Primary Identifier  MGI:6511815 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Ttn
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false
molecularNote  Using CRISPR/Cas9 technology with an sgRNA (targeting AGCTCTTCCAACGCTGTTGG) and an ssODN template, a C-to-A mutation (c.533C>A) that changes alanine codon 178 to an aspartic acid codon (p.A178D) was created. This mutation mimics a mutation found in a family of autosomal dominant left ventricular non-compaction (LVNC) and familial dilated cardiomyopathy (DCM) patients. Transcript and peptide expression was not affected by this mutation, nor was localisation of the peptide.
  • mutations:
  • Single point mutation
  • synonyms:
  • A178D,
  • A178D
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories