|  Help  |  About  |  Contact Us

Allele : Stra8<em3Keish> stimulated by retinoic acid gene 8; endonuclease-mediated mutation 3, Kei-ichiro Ishiguro

Primary Identifier  MGI:6488116 Allele Type  Endonuclease-mediated
Attribute String  Epitope tag, Null/knockout, Reporter Gene  Stra8
Strain of Origin  (C57BL/6J x 129S6/SvEvTac)F1 Is Recombinase  false
Is Wild Type  false
molecularNote  This allele is derived from the Stra8em1Keish allele, which was generated as follows: sequence for three FLAG tags and an HA tag was inserted in-frame into the 3' UTR in exon 9, followed by p2A self-cleaving sequence and the GFP fluorescent marker gene, using CRISPR/Cas9 technology with gRNAs targeting GCCTCAGGTCACATTATCGG(tgg) and TGCAATCAGTTCCGACTCTC(tgg). A neomycin resistance gene cassette was inserted downstream of the gene. Subsequent CRISPR/Cas9 targeting with a crRNA (targeting ACAGATCGTCAAAGGTCTCC(agg) in exon 9) and tracrRNA resulted in a 2 bp (GA) deletion and 1 bp insertion (C).
  • mutations:
  • Intragenic deletion,
  • Insertion
  • synonyms:
  • Stra8 KO,
  • Stra8 KO
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele