| Primary Identifier | MGI:6488116 | Allele Type | Endonuclease-mediated |
| Attribute String | Epitope tag, Null/knockout, Reporter | Gene | Stra8 |
| Strain of Origin | (C57BL/6J x 129S6/SvEvTac)F1 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | This allele is derived from the Stra8em1Keish allele, which was generated as follows: sequence for three FLAG tags and an HA tag was inserted in-frame into the 3' UTR in exon 9, followed by p2A self-cleaving sequence and the GFP fluorescent marker gene, using CRISPR/Cas9 technology with gRNAs targeting GCCTCAGGTCACATTATCGG(tgg) and TGCAATCAGTTCCGACTCTC(tgg). A neomycin resistance gene cassette was inserted downstream of the gene. Subsequent CRISPR/Cas9 targeting with a crRNA (targeting ACAGATCGTCAAAGGTCTCC(agg) in exon 9) and tracrRNA resulted in a 2 bp (GA) deletion and 1 bp insertion (C). |
