|  Help  |  About  |  Contact Us

Allele : Slc16a5<em#Memo> solute carrier family 16 (monocarboxylic acid transporters), member 5; endonuclease-mediated mutation 1, Marilyn E Morris

Primary Identifier  MGI:6476744 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Slc16a5
Strain of Origin  C57BL/6NCr Is Recombinase  false
Is Wild Type  false
molecularNote  Exon 2 was targeted with sgRNAs (AGCATCTTGGTCAAACATTTCGG, CTGTGATCACTCCTGCGGTGAGG) using CRISPR/Cas9 technology, resulting in two mutant mouse lines: a 105 bp deletion and unknown size insertion in one line and a108 bp deletion in the other. The pound # symbol is used where the specific allele used is not mentioned or where the alleles are pooled.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Mct6<->,
  • Mct6<->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories