| Primary Identifier | MGI:6476744 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Slc16a5 |
| Strain of Origin | C57BL/6NCr | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Exon 2 was targeted with sgRNAs (AGCATCTTGGTCAAACATTTCGG, CTGTGATCACTCCTGCGGTGAGG) using CRISPR/Cas9 technology, resulting in two mutant mouse lines: a 105 bp deletion and unknown size insertion in one line and a108 bp deletion in the other. The pound # symbol is used where the specific allele used is not mentioned or where the alleles are pooled. |