| Primary Identifier | MGI:6512052 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Spi1 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Guide RNAs (GCTATGCTTAAGTCAGGCTT and ATTGTGGCTATGCTTAAGTC) are designed to create a C to T missense mutation resulting in a mutation orthologous to the location of human SNP rs1377416. Human SNP rs1377416 has been found in human SPI1 and is a functional variant that is active in human myeloid cells and in the brain of a mouse model of Alzheimer's disease (AD). |
