| Help | About | Contact Us

Allele : Del(XJpx-Ftx)1Ehea deletion, Chr X, Edith Heard 1

Primary Identifier	MGI:6473332	Allele Type	Endonuclease-mediated
Attribute String	Null/knockout	Gene	Del(XJpx-Ftx)1Ehea
Strain of Origin	(C57BL/6 x DBA/2)F1	Is Recombinase	false
Is Wild Type	false

molecularNote

A section of chromosome X encompassing the Jpx and Ftx lncRNA loci was deleted using sgRNAs (GGTCACAATTATGCAACCTG, ATACTCCGGATTACATACTC, TGCCCAAGCAAAAAGCGTGA, AAAGTATTGACACCTTACCC) with CRISPR/Cas9 technology.

mutations:
Intragenic deletion,
Intergenic deletion

synonyms:
deltaJpx deltaFtx,
deltaJpx deltaFtx

1 Feature

Genome

0 Expresses

2 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

Other

0 Carried By

0 Driven By

3 Publication categories

Questions? Comments? Click here!

MouseMine is a collaboration between MGI at The Jackson Laboratory and the InterMine project at the Cambridge Systems Biology Centre. MouseMine is funded through a grant from the NIH/NHGRI.The Jackson Laboratory makes no representation about the suitability or accuracy of this software or data for any purpose, and makes no warranties, either express or implied, including merchantability and fitness for a particular purpose or that the use of this software or data will not infringe any third party patents, copyrights, trademarks, or other rights. the software and data are provided "as is". This software and data are provided to enhance knowledge and encourage progress in the scientific community and are to be used only for research and educational purposes. Any reproduction or use for commercial purpose is prohibited without the prior express written permission of the Jackson Laboratory.

Your name:
Your email address:
Subject:
Message:	---- Current page: ---- /mousemine/report.do?id=76695319

MouseMine