| Primary Identifier | MGI:6509459 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence, Hypomorph | Gene | Ppil1 |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Using a gRNA (targeting GTCTGGTCCTGCGTTGGCCA) and an ssODN template (TGCCCTTCATGCTCTTCTCTCTCCTTATGTCCCCAGGGGCTGGGATTCTCACGATGGCCAACGCAGGACCAGACACCAATGGCAGCCAGTTCTTTGTGACC) with CRISPR/Cas9 technology, two point mutations were engineered to change alanine codon 99 (GCC) to a threonine codon (ACG) (p.A99T). This mutation mimics a human mutation found in pontocerebellar hypoplasia plus microcephaly (PCHM) patients. |
