| Primary Identifier | MGI:6509462 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Ppil1 |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Using a crRNA (targeting TCCCTATACCCTGGCACACT), a tracrRNA and an ssODN template (GGTCCTGGGAGTTTGTTTCCACCATGCCCACTCGATTCACCATCCCTATACCCTGGCACACTTGTCCAAAAATAGTATGCTTGCCGTCCAGCCATTGCGTGGGGGCCAGGGTCACAAAGAAC) with CRISPR/Cas9 technology, a single G-to-A mutation (C-to-T on forward strand) was engineered to change arginine codon 131 (CGA) to a glutamine codon (CAA) (p.R131Q). This mutation mimics a human mutation found in pontocerebellar hypoplasia plus microcephaly (PCHM) patients. |
