|  Help  |  About  |  Contact Us

Allele : Cdc40<em1Jgg> cell division cycle 40; endonuclease-mediated mutation 1, Joseph Gleeson

Primary Identifier  MGI:6509468 Allele Type  Endonuclease-mediated
Attribute String  Not Specified Gene  Cdc40
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  Using a crRNA (targeting TTCCTTATATCGTTGCAGTT), tracrRNA and an ssODN template (GGATTAGAGTTGAAAATACATTGTAATTTCAGGATCCTTCTTTTCCTTCCTTATATCGTTGCAGTTTGGAGCAGAAAATCCCTTTCGAACACAGCAAATGGCTGCCCCTAGAAATATGCTTTCTGGGTATGCAGAGCCAGC) with CRISPR/Cas9 technology, a C-to-G mutation (G-to-C on forward strand) was engineered to change proline codon 95 (CCA) to an alanine codon (GCA) (p.P95A). This mutation creates a non-isomerizable form of the encoded peptide.
  • mutations:
  • Single point mutation
  • synonyms:
  • Prp17<p.P95A>,
  • Prp17<p.P95A>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories