|  Help  |  About  |  Contact Us

Allele : Cdc40<em2Jgg> cell division cycle 40; endonuclease-mediated mutation 2, Joseph Gleeson

Primary Identifier  MGI:6509469 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cdc40
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  Using a crRNA (targeting TTCCTTATATCGTTGCAGTT) and tracrRNA with CRISPR/Cas9 technology, an 11 bp deletion was created (NM_027879.2:c.277_287delTTTGGACCAGA), resulting in a frameshift and premature stop codon.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories