|  Help  |  About  |  Contact Us

Allele : Vps35l<em2Shis> VPS35 endosomal protein sorting factor like; endonuclease-mediated mutation 2, Shinji Saitoh

Primary Identifier  MGI:6507963 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Vps35l
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false
molecularNote  Exon 10 was targeted with an sgRNA (targeting CCATCCGGGAACTCATTCCAAGA) using CRISPR/Cas9 technology, resulting in a 2 bp deletion of GG and a 7 bp insertion of ATTCCAA. Exon 10 contains mutations in human patients presenting with a phenotype similar to, but distinct from, cranio-cerebello-cardiac/Ritscher-Schinzel syndrome (3C/RSS).
  • mutations:
  • Intragenic deletion,
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories