|  Help  |  About  |  Contact Us

Allele : Lrrc55os<em1Caox> leucine rich repeat containing 55, opposite strand; endonuclease-mediated mutation 1, Xuetao Cao

Primary Identifier  MGI:6477292 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout, Reporter Gene  Lrrc55os
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  Exon 1 was targeted with sgRNAs (TAGGCTCTCTGCAATGGCTGAC, AAACGTCAGCCATTGCAGAGAG, TAGGGGTAAGCAGGTTGCTGA and AAACCTCAGCAACCTGCTTACC) and a donor plasmid containing a GFP gene and poly(A) signal sequence using CRISPR/Cas9 technology. This resulted an a knockout reporter allele where exon 1 is replaced with the GFP gene.
  • mutations:
  • Insertion,
  • Intragenic deletion
  • synonyms:
  • lncLrrc55-AS,
  • lncLrrc55-AS
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories