|  Help  |  About  |  Contact Us

Allele : Lrrc55os<em1Caox> leucine rich repeat containing 55, opposite strand; endonuclease-mediated mutation 1, Xuetao Cao
Primary Identifier  MGI:6477292 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout, Reporter Gene  Lrrc55os
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  Exon 1 was targeted with sgRNAs (TAGGCTCTCTGCAATGGCTGAC, AAACGTCAGCCATTGCAGAGAG, TAGGGGTAAGCAGGTTGCTGA and AAACCTCAGCAACCTGCTTACC) and a donor plasmid containing a GFP gene and poly(A) signal sequence using CRISPR/Cas9 technology. This resulted an a knockout reporter allele where exon 1 is replaced with the GFP gene.
  • mutations:
  • Insertion,
  • Intragenic deletion
  • synonyms:
  • lncLrrc55-AS,
  • lncLrrc55-AS
Paste the following link
Quick Links:
SummaryGenomePhenotypeOther
 
Quick Links:
SummaryGenomePhenotypeOther
 
Lists
This Allele isn't in any lists. Upload a list.

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele




MouseMine is a collaboration between MGI at The Jackson Laboratory and the InterMine project at the Cambridge Systems Biology Centre. MouseMine is funded through a grant from the NIH/NHGRI.The Jackson Laboratory makes no representation about the suitability or accuracy of this software or data for any purpose, and makes no warranties, either express or implied, including merchantability and fitness for a particular purpose or that the use of this software or data will not infringe any third party patents, copyrights, trademarks, or other rights. the software and data are provided "as is". This software and data are provided to enhance knowledge and encourage progress in the scientific community and are to be used only for research and educational purposes. Any reproduction or use for commercial purpose is prohibited without the prior express written permission of the Jackson Laboratory.

Copyright © 2017 by The Jackson Laboratory. All Rights Reserved

© 2002 - 2017 Department of Genetics, University of Cambridge, Downing Street,
Cambridge CB2 3EH, United Kingdom