| Primary Identifier | MGI:6507752 | Allele Type | Endonuclease-mediated |
| Attribute String | Conditional ready, Reporter | Gene | Gt(ROSA)26Sor |
| Strain of Origin | B6.Cg-Gt(ROSA)26Sor<tm9(CAG-tdTomato)Hze>/J | Is Recombinase | false |
| Is Wild Type | false | Project Collection | CPMM |
| description | This allele was generated from Gt(ROSA)26Sortm9(CAG-tdTomato)Hze. |
| molecularNote | Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTATT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression. |
