|  Help  |  About  |  Contact Us

Allele : Gt(ROSA)26Sor<em1(CAG-tdTomato)Jahe> gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 1, Jason Heaney

Primary Identifier  MGI:6507752 Allele Type  Endonuclease-mediated
Attribute String  Conditional ready, Reporter Gene  Gt(ROSA)26Sor
Strain of Origin  B6.Cg-Gt(ROSA)26Sor<tm9(CAG-tdTomato)Hze>/J Is Recombinase  false
Is Wild Type  false Project Collection  CPMM
description  This allele was generated from Gt(ROSA)26Sortm9(CAG-tdTomato)Hze.
molecularNote  Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTATT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression.
  • mutations:
  • Insertion
  • synonyms:
  • Ai9-SauSpyCas9,
  • Ai9-SauSpyCas9
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele