|  Help  |  About  |  Contact Us

Allele : Ldlrad3<em2Diam> low density lipoprotein receptor class A domain containing 3; endonuclease-mediated mutation 2, Michael S Diamond

Primary Identifier  MGI:6509991 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ldlrad3
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  Exon 2 was targeted with two sgRNAs (targeting CAGCAACGGGCGGTGCATCC and CGTCACACTGCCAGGCGCCC) using CRISPR/Cas9 technology, resulting in a 14 bp deletion (CGGTGCATCCCGGG [CCCGGGATGCACCG on forward strand]).
  • mutations:
  • Intragenic deletion
  • synonyms:
  • deltaLdlrad3,
  • deltaLdlrad3
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories