| Primary Identifier | MGI:6510021 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Sprr2f |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Exon 2, containing the CDS, was targeted with two sgRNAs (targeting AGACAGGCAGTCTCGAGTTC and GGGGAAGAGTACTTTCTATG) using CRISPR/Cas9 technology, resulting in a 1258 bp deletion (including the entire exon). Lack of transcript expression from this allele was confirmed by qRT-PCR. |
