| Primary Identifier | MGI:6507962 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Vps35l |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Exon 10 was targeted with an sgRNA (targeting CCATCCGGGAACTCATTCCAAGA) using CRISPR/Cas9 technology, resulting in a 2 bp deletion of CG. Exon 10 contains mutations in human patients presenting with a phenotype similar to, but distinct from, cranio-cerebello-cardiac/Ritscher-Schinzel syndrome (3C/RSS). |
