| Primary Identifier | MGI:6505622 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cacng2 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Exon 1 was targeted with an sgRNA (targeting TGAAACCAGCAAGAAGAACG) and an ssODN template, containing a A-to-T mutation (T-to-A on forward strand) in lysine codon 53, using CRISPR/Cas9 technology. The resulting mutation causes premature translation termination (p.K53*). |
