|  Help  |  About  |  Contact Us

Allele : Cacng2<em1Tern> calcium channel, voltage-dependent, gamma subunit 2; endonuclease-mediated mutation 1, Terunaga Nakagawa

Primary Identifier  MGI:6505622 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cacng2
Is Recombinase  false Is Wild Type  false
molecularNote  Exon 1 was targeted with an sgRNA (targeting TGAAACCAGCAAGAAGAACG) and an ssODN template, containing a A-to-T mutation (T-to-A on forward strand) in lysine codon 53, using CRISPR/Cas9 technology. The resulting mutation causes premature translation termination (p.K53*).
  • mutations:
  • Single point mutation
  • synonyms:
  • CACNG2<->,
  • CACNG2<->
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories

Trail: Allele