| Primary Identifier | MGI:6501985 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Bin1 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Guide RNA (GATGAGCTGCAACTCAAAGC) is designed to create an AAA to AGG missense mutation resulting in a lysine to arginine change at amino acid 537 (K537R). The K537R mutation is homologous to the human K542R SNP which has been shown to correlate with increased risk of sporadic Alzheimer's disease. One silent DNA mutation was also introduced. |
