|  Help  |  About  |  Contact Us

Allele : Bin1<em1Aduci> bridging integrator 1; endonuclease-mediated mutation 1, Frank LaFerla

Primary Identifier  MGI:6501985 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Bin1
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Guide RNA (GATGAGCTGCAACTCAAAGC) is designed to create an AAA to AGG missense mutation resulting in a lysine to arginine change at amino acid 537 (K537R). The K537R mutation is homologous to the human K542R SNP which has been shown to correlate with increased risk of sporadic Alzheimer's disease. One silent DNA mutation was also introduced.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • BIN1<K358R>,
  • BIN1<K358R>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele