| Primary Identifier | MGI:6512875 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zmat3 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | The genomic region containing exons 2-5 was targeted with two sgRNAs (targeting GTCAAGCATACTCCATACCC and GCGGTGTGAATTGCTGTGCC) using CRISPR/Cas9 technology, resulting in a 19773 bp deletion (deleting exons 2-5) and 2 bp insertion (CG). Western blots confirmed the absence of peptide expression from this allele. |
