|  Help  |  About  |  Contact Us

Allele : Zmat3<em1Ast> zinc finger matrin type 3; endonuclease-mediated mutation 1, Andreas Strasser

Primary Identifier  MGI:6512875 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Zmat3
Is Recombinase  false Is Wild Type  false
molecularNote  The genomic region containing exons 2-5 was targeted with two sgRNAs (targeting GTCAAGCATACTCCATACCC and GCGGTGTGAATTGCTGTGCC) using CRISPR/Cas9 technology, resulting in a 19773 bp deletion (deleting exons 2-5) and 2 bp insertion (CG). Western blots confirmed the absence of peptide expression from this allele.
  • mutations:
  • Intragenic deletion,
  • Insertion
  • synonyms:
  • Zmat3<->,
  • Zmat3<->
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

4 Publication categories

Trail: Allele