| Primary Identifier | MGI:6510587 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Borcs5 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Exon 2 was targeted with two sgRNAs (targeting ATCTTGGCCCGATGTTTAGC and GGCTAAACATCGGGCCAAGA) using CRISPR/Cas9 technology, resulting in a 10 bp deletion (GATGGACGAT) that leads to a frameshift and premature stop codon. |
